RNA-MoIP is an integer programming framework for predicting RNA structures by inserting local 3D motifs. It works with the program MC-Sym to produce a pool of predicted 3D models. This web server automates the pipeline for processing a primary sequence input to RNA-MoIP to the MC-Sym script, and allows users to visualize the inserted motifs.

A description of the RNA-MoIP algorithm can be found in the paper Vladimir Reinharz, François Major, and Jérôme Waldispühl. Towards 3D structure prediction of large RNA molecules: an integer programming framework to insert local 3D motifs in RNA secondary structure. Bioinformatics (Proceedings of ISMB 2012; Also appear in Conference Section), 28(12):i207-14, June 2012.

Workflow

The user enters a sequence (and optional structure) to be processed by RNA-MoIP. RNA-MoIP determines the optimal motif insertions and generates a MC-Sym formatted input script. The user downloads this script and uploads it to the MC-Sym server, which computes a pool of predicted 3D structures.

Input

Advanced Options:

Results:

Sample Sequences:

Sample sequences can be set or loaded (pre-loaded working directory) under the Advanced Options menu.
  1. 3E5C

    GUUCCCGAAAGGAUGGCGGAAACGCCAGAUGCCUUGUAACCGAAAGGGGGAAU
  2. 1DK1

    GGGCGGCCUUCGGGCUAGACGGUGGGAGAGGCUUCGGCUGGUCCACCCGUGACGCUC
  3. 1MMS

    GCUGGGAUGUUGGCUUAGAAGCAGCCAUCAUUUAAAGAGUGCGUAACAGCUCACCAGC
  4. 2DU3

    GCCAGGGUGGCAGAGGGGCUUUGCGGCGGACUGCAGAUCCGCUUUACCCCGGUUCGAAUCCGGGCCCUGGC
  5. 3D2G

    GGGACCAGGGGUGCUUGUUCACAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUC
  6. 2HOJ

    GCGACUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUCGCA
  7. 2GDI

    GGACUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUUC
  8. 1LNG

    UCGGCGGUGGGGGAGCAUCUCCUGUAGGGGAGAUGUAACCCCCUUUACCUGCCGAACCCCGCCAGGCCCGGAAGGGAGCAACGGUAGGCAGGACGUC
  9. 1MFQ

    GACACUAAGUUCGGCAUCAAUAUGGUGACCUCCCGGGAGCGGGGGACCACCAGGUUGCCUAAGGAGGGGUGAACCGGCCCAGGUCGGAAACGGAGCAGGUCAAAACUCCCGUGCUGAUCAGUAGUGUC
  10. FASTA Input

    >1DK1:B|PDBID|CHAIN|SEQUENCE
    GGGCGGCCUUCGGGCUAGACGGUGGGAGAGGCUUCGGCUG
    GUCCACCCGUGACGCUC
    >2GDI:X|PDBID|CHAIN|SEQUENCE
    GGACUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACC
    CGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUUC
    >1MMS:D|PDBID|CHAIN|SEQUENCE
    GCUGGGAUGUUGGCUUAGAAGCAGCCAUCAUUUAAAGAGU
    GCGUAACAGCUCACCAGC

MC-Sym

MC-Sym is used to predict all-atom RNA tertiary structures from the RNA-MoIP pre-processed scripts. Upon redirection, a working directory is created that is populated by model predictions as they are computed.

Structures take the format "structure-XXXX.pdb.gz". It may take some time for models to be computed so results may not appear immeidately. Information about the job can be found in mcsym.out.

IMPORTANT: before downloading the models, it is highly recommended to perform minimization. MC-Sym uses fragments for the PDBs that entirely reconstruct the backbone, which often renders it as discontinuous stretches when the structure is viewed. Minimization commands can be found in commands.html. Minimization can only be applied to generated structures, so users should wait until structures have appeared before applying this option. Minimization-Relieve is the fastest setting (recommended).

Full documentation of MC-Sym can be found at http://www.major.iric.ca/MC-Pipeline/manual.pdf

MC-Sym Output: Left: The working directory for MC-Sym. Candidate structures (in red box) appear as they are computed. Right: The commands menu. Users are recommended to perform minimization once sufficient results have been generated.